e2f2  (Addgene inc)

Journal: Nature

Article Title: Targeting G1–S-checkpoint-compromised cancers with cyclin A/B RxL inhibitors

doi: 10.1038/s41586-025-09433-w

Figure Lengend Snippet: a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Article Snippet: To make the DOX-on pTripz neo E2F1, E2F2 or E2F3 construct, pDONR223 E2F1 (W. G. Kaelin’s laboratory), pCMVHA E2F2 (Addgene, 24226) and pCMV Tag2B E2F3 (Addgene, 202522) were used as templates for overhang PCR to introduce the attB1 and attB2 sites onto the 5′ and 3′ ends of E2F1 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCCTTGGCCGGGGCCCCTGCG; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATCCAGGGGGGTGAGGTCCCC-3′), E2F2 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCAAGGGCCCCGGGCCTTG-3′; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCAACAGGTCCCCAAGGTC-3′) and E2F3 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAGAAAGGGAATCCAGCCCGCT; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTACTACACATGAAGTCTTCCACCAG-3′).

Techniques: Western Blot, Infection, Quantitation Assay, Concentration Assay, Expressing, Control

Journal: Nature

Article Title: Targeting G1–S-checkpoint-compromised cancers with cyclin A/B RxL inhibitors

doi: 10.1038/s41586-025-09433-w

Figure Lengend Snippet: a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Article Snippet: To make the DOX-on pTripz neo E2F1, E2F2 or E2F3 construct, pDONR223 E2F1 (W. G. Kaelin’s laboratory), pCMVHA E2F2 (Addgene, 24226) and pCMV Tag2B E2F3 (Addgene, 202522) were used as templates for overhang PCR to introduce the attB1 and attB2 sites onto the 5′ and 3′ ends of E2F1 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCCTTGGCCGGGGCCCCTGCG; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATCCAGGGGGGTGAGGTCCCC-3′), E2F2 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCAAGGGCCCCGGGCCTTG-3′; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCAACAGGTCCCCAAGGTC-3′) and E2F3 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAGAAAGGGAATCCAGCCCGCT; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTACTACACATGAAGTCTTCCACCAG-3′).

Techniques: Western Blot, Infection, Quantitation Assay, Concentration Assay, Expressing, Control

Journal: Biomolecules

Article Title: Molecular Regulation of Heme Oxygenase-1 Expression by E2F Transcription Factor 2 in Lung Fibroblast Cells: Relevance to Idiopathic Pulmonary Fibrosis.

doi: 10.3390/biom12101531

Figure Lengend Snippet: Figure 4. E2F2 suppresses HO-1 expression. (A) IMR90 cells were transfected with E2F2 siRNA for 72 h. E2F2 and HO-1 mRNA levels were examined by real-time PCR. ** p < 0.01, n = 4. (B) Protein levels of HO-1 and β-actin were analyzed by immunoblots. Intensities of HO-1 blots were analyzed by Image J. * p < 0.05, n = 3. (C) E2F2 plasmid was transfected into IMR90 cells for 48 h, and cell lysates were analyzed by western blots with HO-1 and β-actin antibodies. Intensities of HO-1 blots were analyzed by Image J. * p < 0.05, n = 4. (D,E) E2F4 and E2F6 were knocked down in IMR90 cells by esiRNA for 72 h, and E2F4, E2F6, HO-1, and β-actin levels were analyzed by Western blots (n = 2). (F) After knockdown of E2F4 and E2F6 in IMR90 cells for 72 h, mRNA expression of E2F4, E2F6, and HO-1 were examined by real-time PCR (n = 5). (G) esiRNA was used to downregulate expression of E2F1; protein expression of HO-1, E2F1 and β-actin were analyzed by immunoblots (n = 3).

Article Snippet: The E2F2 plasmid was a gift from Kristain Helin (Addgene plasmid #24226), and HO-1-Myc was obtained from Origene (Rockville, MD, USA).

Techniques: Expressing, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Plasmid Preparation, esiRNA, Knockdown

Journal: Biomolecules

Article Title: Molecular Regulation of Heme Oxygenase-1 Expression by E2F Transcription Factor 2 in Lung Fibroblast Cells: Relevance to Idiopathic Pulmonary Fibrosis.

doi: 10.3390/biom12101531

Figure Lengend Snippet: Figure 5. E2F2 does not affect hemin-induced HO-1 expression. (A) IMR90 cells were treated with 5 µM hemin for 0, 3, or 24 h. HO-1 protein expression was analyzed by Western blots. Intensities of HO-1 were analyzed by Image J. ** p < 0.01, * p < 0.05, n = 3. (B) IMR90 cells were transfected with E2F2 plasmid for 48 h, then treated with 1 or 5 µM hemin for 3 h. Cell lysates were analyzed by Western blots with HO-1, E2F2, and β-actin antibodies. Intensities of HO-1 bands were analyzed by Image J. ** p < 0.01, * p < 0.05, n = 3–4.

Article Snippet: The E2F2 plasmid was a gift from Kristain Helin (Addgene plasmid #24226), and HO-1-Myc was obtained from Origene (Rockville, MD, USA).

Techniques: Expressing, Western Blot, Transfection, Plasmid Preparation

Journal: Biomolecules

Article Title: Molecular Regulation of Heme Oxygenase-1 Expression by E2F Transcription Factor 2 in Lung Fibroblast Cells: Relevance to Idiopathic Pulmonary Fibrosis.

doi: 10.3390/biom12101531

Figure Lengend Snippet: Figure 7. HO-1 regulates phosphorylation of AKT. (A) esiRNA was used to knockdown HO-1 levels in IMR90 cells for 72 h, then HO-1, P-AKT, AKT, and β-actin protein levels were quantitated by immunoblots. Intensities of P-AKT bands were normalized to β-actin and quantified by Image J. * p < 0.05, n = 3. (B) IMR90 cells were treated with 1–20 µM HLM for 24 h. Protein expression of AKT, P-AKT, HO-1, and β-actin were quantitated by Western blots. Intensities of P-AKT bands were normalized to β-actin and quantified by Image J. * p < 0.05; ** p < 0.01, n = 3. (C) E2F2 plasmid was transfected into IMR90 cells for 48 h, and cell lysates were quantitated by Western blots with P-AKT, E2F2, and β-actin antibodies. Intensities of P-AKT bands were normalized to β-actin and quantified by Image J. ** p < 0.01, n = 3.

Article Snippet: The E2F2 plasmid was a gift from Kristain Helin (Addgene plasmid #24226), and HO-1-Myc was obtained from Origene (Rockville, MD, USA).

Techniques: Phospho-proteomics, esiRNA, Knockdown, Western Blot, Expressing, Plasmid Preparation, Transfection